Oxidation of methionine, which was chosen as a variable modification parameter, added another 16 Da to the peptide mass which subsequently increased the mass of the NSPLASMSNINYAPTIWSR fragment to 2,138 Da. This mass was exactly the same as the mass of a recovered peptide which did not find a match during the NCBI search since the respective fusion peptide SB202190 cell line is not present in the database. Thus, the synthesis of the LscBUpNA fusion protein could also be proven. The majority of previous LscA-related studies have been performed with P. syringae pv. glycinea PG4180 [9, 10, 23, 24]. However, thus far, there was no evidence for a lack of lscA expression in other pathovars of P. syringae. Since the genomes

of P. syringae pv. phaseolicola 1448A, pv. syringae B728a and pv. tomato DC3000 are fully sequenced [19–21], template-specific oligonucleotide primers for cDNA-based mRNA detection could be designed. Although mRNA samples were extracted during different growth stages, namely, early-logarithmic and late-logarithmic phase, no amplicons could be detected in

any of the strains suggesting that lscA variants were not expressed. PCR amplification, using respective genomic DNA as template, proved that the primers were binding correctly. An independent gene, hexR, coding for a conserved hexose metabolism regulator protein HexR, was chosen to see if the total mRNA had been reverse transcribed correctly [25]. This PCR amplification gave correct sized amplicon of 880-bp for all the four strains demonstrating the accuracy of the used method. PCR amplification was also performed on the cDNA obtained from mRNA samples of PG4180.M6 containing Selleck AZD3965 lscA under the control of P lac . This experiment gave the same-sized amplicon as for genomic DNA again proving the accuracy of the method. In summary, for we propose that lscA could be an ancestral Lsc variant in P. syringae as suggested by high throughput screening Srivastava et al. [24]. During evolution, the inactive promoter perhaps did not allow expression

of lscA after this gene had potentially been introduced to an ancestral P. syringae. An evolutionary gene duplication of lscA followed by an insertion of a prophage-borne PAPE might have led to a new lsc variant, i.e. lscB which in turn got duplicated yielding lscC or vice-versa. As a result of this evolutionary process, two functional and expressed lsc genes emerged in the plant pathogen, for which utilization of sucrose, and perhaps levan formation, might be particularly important. The advantage of an additional in planta fitness-increasing and possibly virulence-promoting factor [29] could have helped this organism to selectively establish itself as a potent plant pathogen. As a consequence of this hypothesis, one could speculate on a loss of the supposedly non-expressed lscA during further evolutionary steps, a phenomenon also previously hypothesized by Smits et al. [30]. Conclusions The differential expression of levansucrases in P.

Standard curves created for all primers had a slope of -3.3 ± 0.3 (data not shown). For quantification of amplicons, an individual gene was first amplified by PCR and cloned into the pGEM-Teasy vector (Promega, Madison, WI). Recombinant plasmid DNA was then purified and diluted serially 10-fold to generate a standard curve. Transcript copies corresponding to each gene of interest were calculated Pevonedistat in vivo using the Absolute Quantification Analysis program (Applied Biosystems) and normalized against copies of flaB. Table 1 Oligonucleotide primers

used in this study Gene Forward (5′-3′) Reverse (5′-3′) Cloning     flaB GGGAACTTGATTAGCCTGCGCAAT TCGAGCTTCTGATGATGCTGCT rpoS CTTGCAGGACAAATACAAAGAGGC TGGGACTATTGTCCAGGTTATATCTTT ospC CTGCTGATGAGTCTGTTAAAGGGC TTTGGACTTTCTGCCACAACAGGG ospA GCGTTTCAGTAGATTTGCCTGGTG

CCCTCTAATTTGGTGCCATTTGAGTCG dbpA CTTATATCATGTGGACTAACAGGAGC AGCACTCCTTGAGCTGTAGTTGGA qRT-PCR     flaB TGATTAGCCTGCGCAATCATT AATGACAGATGAGGTTGTAGCAGC rpoS CTGGACAAAGAAATAGAGGGATCTG CAAGGGTAATTTCAGGGTTAAAAGAA ospC GTACTAAAACTAAAGGTGCTGAAGAA GCATCTCTTTAGCTGCTTTTGACA ospA GGCGTAAAAGCTGACAAAAGTAAAGT TGTTTTGCCATCTTCTTTGAAAAC dbpA ACGAAGCGCTAAAGACATTACAGA GGCATCAAAATTTACGCCCTTA Acknowledgements We thank Jianli Zhou for Cell Cycle inhibitor technical assistance. This work was supported by NIH-NIAID Grants P-gp inhibitor AI-059062 (to MVN), AI-076705 (to SN) and AI-080615 (to UP), an Arthritis Foundation fellowship (to GN), and an award from the American Heart Association (to ZO). References 1. Bacon RM, Kugeler KJ, Mead Isotretinoin PS: Surveillance for Lyme disease-United States, 1992–2006. MMWR Surveill Summ 2008,57(10):1–9.PubMed 2. Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, Davis JP: Lyme disease-a tick-borne spirochetosis? Science 1982,216(4552):1317–1319.PubMedCrossRef 3. Steere AC, Grodzicki RL, Kornblatt AN, Craft JE, Barbour AG, Burgdorfer W, Schmid GP, Johnson E, Malawista SE: The spirochetal etiology of Lyme disease. N Engl J Med 1983,308(13):733–740.PubMedCrossRef 4. de Silva AM, Telford SR, Brunet LR, Barthold SW, Fikrig E: Borrelia burgdorferi OspA is an arthropod-specific transmission-blocking Lyme disease vaccine.

J Exp Med 1996,183(1):271–275.PubMedCrossRef 5. Hodzic E, Feng S, Freet KJ, Borjesson DL, Barthold SW: Borrelia burgdorferi population kinetics and selected gene expression at the host-vector interface. Infect Immun 2002,70(7):3382–3388.PubMedCrossRef 6. Montgomery RR, Malawista SE, Feen KJ, Bockenstedt LK: Direct demonstration of antigenic substitution of Borrelia burgdorferi ex vivo: exploration of the paradox of the early immune response to outer surface proteins A and C in Lyme disease. J Exp Med 1996,183(1):261–269.PubMedCrossRef 7. Ohnishi J, Piesman J, de Silva AM: Antigenic and genetic heterogeneity of Borrelia burgdorferi populations transmitted by ticks. Proc Natl Acad Sci USA 2001,98(2):670–675.PubMedCrossRef 8.

Figure 4 The activation profiles of macrophages treated with IFN-γ or IL-10 and infected with pathogenic mycobacteria. BMDM were pretreated, or not, with murine r-IFN-γ or r-IL-10 for 2 h, infected with the studied mycobacterial strains at a MOI of 5:1, washed, treated again with the cytokines and incubated for an additional 48 h. The cells stimulated with LPS and r-IFN-γ

for 48 h, or left untreated, were used as a positive and negative controls of classical proinflammatory activation, respectively. To evaluate markers of M1-type activation, the culture supernatants were tested for proinflammatory mediator levels (A-C) and the adhered cells were tested for expression of iNOS (D). Measurement of TNF-α, IL-6, MCP-1, MIP-2 and IL-12 concentrations was performed by Bioplex test, and p38 MAPK inhibitors clinical trials NO production was evaluated by Griess reaction Assays were completed with duplicate samples, and results are expressed as a mean of three independent experiments. To evaluate markers of M2-type activation, expression of Arginase 1 and MR/CD206 in the adhered cells was tested by Western blotting (E) and secretion of IL-10 was quantified by Bioplex assay (F). Lower panels in D and

E, quantification of the protein levels by densitometric analysis of immunoreactive bands. Asterisks in A, B and F indicate the infected cultures treated with recombinant IFN-γ or IL-10, for which the induced cytokine production differed significantly from that in the corresponding cultures incubated without the presence of exogenic cytokines (*p < 0.05; **p < 0.01; ***p < 0.001). Lines over bars in A and B indicate the Mbv isolates for GS-1101 cost which the induced cytokine or NO production differed significantly Reverse transcriptase from that induced by H37Rv (#p < 0.01; ##p < 0.001). To verify whether signaling pathways leading to NO production were differentially modulated by the mycobacterial strains, we evaluated induction of iNOS, the essential enzyme for the conversion of arginine to citrulline and NO. The results obtained showed that treatment with IFN-γ induced iNOS expression in the cultured macrophages, and subsequent infection of these cells with bacteria enhanced the level

of enzyme expression in a similar manner (Figure 4D), demonstrating no strain-specific difference in the regulation of IFN-γ-dependent signaling which leads to transactivation of the iNOS gene. Evaluation of expression of M2 markers in the cells pretreated with IFN-γ demonstrated suppression of Arg-1 expression induced by the strains B2 and H37Rv, but not those infected with strain MP287/03 (Figure 4E). Expression of MR by MΦ was slightly selleck chemicals inhibited in the cell cultures treated with IFN-γ, and further reduced after infection of these cells with the strains B2 or H37Rv. In contrast, infection with the strain MP287/03 restored a high level of expression of this receptor (Figure 4E), suggesting induction of MR gene transcription due to mycobacteria in these cells.

5%. The minimum transmission of the samples in the visible and the near-infrared range is over 85%, completely meeting the optical condition of see more transparent conducting films. Theoretically, the transparency of graphene drops quickly with thickness [8]. However, the actual measured transparency of graphene is not closely obeying it. For instance, Wang et al. reported that the transparency of GO is over 80% in 550-nm white light for 22 to 78 nm of thickness [27]. The high transparency of our samples is attributed

to the graphene films being composed of many graphene flakes, which allowed light transmission from the tiny pits between flakes. Moreover, the pits between graphene flakes make the actual average thickness often much smaller than

the measured thickness because of the resolution GSK2245840 ic50 of the AFM instrument. Figure 4 The light transmission rate of the graphene samples. (a) Transmission of the graphene films in the 400- to 800-nm range. (b) Transmission of the graphene films in the 1,000- to 3,000-nm range. The optical transmittance of the graphene films is over 85% in the visible range of 400 to 800 nm. The surface current–voltage (I-V) behaviors of the 1, 3, and 5 min graphene films were measured by means of Hall effect measurement, as shown in Figure 5a,b,c. The four measuring electrodes a, b, c, and d were arranged on the surface of the graphene check details films in a square with a side length of 1 cm, as shown the inset in Figure 5a. For the graphene deposited anti-EGFR monoclonal antibody for 1 min, we can see that the I-V behaviors between the four points are not a characteristic of a linear relation, but of a nonlinear property. Especially, I-V bc and I-V cd lines were largely shifted from the linear relation. This is because the graphene on quartz does not form a continuous film but islands by a short time. With deposition time increasing to 3 and 5 min, the graphene islands collected each other to become a continuous film, and then the I-V properties become linear, as shown in Figure 5b,c. I-V da in Figure 5b is far from the other lines which may be caused by the asymmetry

of the four points. The I-V behaviors in Figure 5c all closely obey Ohm’s law. The linear I-V relations of the graphene surface show films with good conductivity. Figure 5 The surface I – V behaviors of the 1, 3, and 5 min graphene samples. (a) 1 min sample. The inset shows the electrodes’ layout on the surface of the graphene film. (b) 3 min sample. (c) 5 min sample. The thickness of the graphene films with deposition time is shown in Figure 6a. We can see that the thickness linearly increases with time. Then we investigated the electron mobility, conductivity, and sheet resistance with the thickness of the graphene films, as shown in Figure 6b,c. The electron mobility is 2.3 × 102, 5.1 × 104, and 9.5 × 104 cm2/V/s for 1, 3, and 5 min samples, respectively.

The MS/MS data were then

searched against a database indexed for only Clostridium spp. for protein identification. Whole genome sequencing and FDA approved Drug Library high throughput analysis Genomic DNA was isolated from strain CDC66177 using the MasterPure kit (Epicenter, Madison, WI) with modifications previously described [23]. This DNA was further purified using a Genomic-tip 100/G column (Qiagen, Valencia, CA). One microgram of genomic DNA was sheared using a Covaris S2 ultrasonicator system to a mean size of 1 Kb. The sheared DNA was used to construct a SMRTbell sequencing library (Pacific Biosciences) according to manufacturer’s instructions. The SMRTbell library was then bound into SMRTbell-DNA polymerase complexes and loaded into zero-mode waveguides (ZMW) on 4 SMRTcells selleck compound and sequenced using Pacific Biosciences C2 chemistry. This relatively small insert sized library was utilized to promote production of circular concensus reads (CCS) which retain higher accuracy

base calls than the longer continuous length reads (CLR). Eight 45 min movies were recorded and processed, yielding ~305 K reads with a mean readlength of 2.9 Kbases and total of SU5402 price 889 Mbases of sequence. CCS reads (140 K reads) were then used to error correct the longer (165 K reads) CLR reads [24] utilizing the Pacific Biosciences analysis script BLASR and then the combined CCS/corrected CLR fastq format reads were imported into CLC Genomics workbench. Sequence reads were then trimmed of any remaining Pacific Biosciences hairpin adaptor sequences and quality trimmed to a base Q value of 20. The filtered reads were then assembled de novo using the CLC denovo assembler. The 188,898 input reads provided a draft assembly of a 3.85 Mb genome comprised of 119 contigs with an N50 value of 87,742 bases with an average coverage of 28X. Annotation of the whole genome sequence was performed using RAST [25]. Pairwise alignments of various genes were made with EMBOSS Needle (http://​www.​ebi.​ac.​uk/​Tools/​psa/​emboss_​needle/​nucleotide.​html). ANI values were determined

using the computer program JSpecies [17]. MLST loci from selected previously reported type E strains were obtained from Genbank [11]. These MLST loci were used to search for the corresponding alleles in the strain 17B genome sequence and Astemizole the CDC66177 whole genome sequence using BLAST. Concatemers of the alleles for each strain were generated and a multiple sequence alignment was performed using CLUSTALW because the lengths of some alleles in strains 17B and CDC66177 differed due to insertion and/or deletions. Acknowledgements Sanger sequencing was performed in the Genomics Unit within the Division of High Consequence Pathogens and Pathology at CDC. This publication was supported by funds made available from the Centers for Disease Control and Prevention, Office of Public Health Preparedness and Response.

This took longer to become apparent in the cyanobacterial species (48 h, Figure 2C) where significant differences from the control also occurred in the sulfite and cysteine treatments. The latter was not the case for Chlamydomonas or Cyanidioschyzon. Here again, this could be accounted for by sulfur metabolism differences between cyanobacteria

and algae, or possibly distinct tolerances to the toxic 4SC-202 nmr effects of these metabolites. High rates of sulfite assimilation into amino acids [34] and high expression of SSU1, buy P505-15 a sulfite efflux gene [35], are known to result in lower toxicity to sulfite in yeast. Similar mechanisms may also occur in Synechococcus. The thermophilic red microalga, Cyanidioschyzon, was capable of biotransforming approximately three times as much Cd(II) into metal sulfide as the mesophilic green alga, Chlamydomonas, when both were grown in 100 μM Cd(II). This ability may be accounted for by its adaptation to sulfur-rich hot springs [36]. In fact, the Cyanidium medium [37] used to grow Cyanidioschyzon contains over an order Quisinostat of magnitude

more sulfate than the high salt medium conventionally used for Chlamydomonas. The sensitivity of Synechococcus to Cd(II) is much higher than in the eukaryotic species. Nevertheless, metal biotransformation into sulfide by this species was only about half of that for Chlamydomonas, indicating that although sensitive to cadmium, it was able to transform a high proportion of the Cd(II)

into metal sulfide. The fact that Synechococcus can convert a relatively high amount of Cd(II) into metal sulfide while remaining very sensitive to Cd(II), might be attributed to a relatively high susceptibility to displacement of metals by Cd as cofactors in photosynthetic and other metabolic enzymes, and to disruption of membrane function [4]. Similarly, this could account for the differences between the algal species. The first report of acid labile sulfide in living organisms was in association with metallothioneins and phytochelatins in fission yeast [38], and it is known that metallothionein gene amplification can confer resistance to cadmium in Synechococcus PCC 6301 [39]. Algal phytochelatins bind cadmium in relatively low metal to peptide amounts [40] and it is likely that CdS Depsipeptide formed in the organisms in the present study are mainly in the form of precipitated nanoparticles, examples of which have been reported in as diverse organisms as Klebsiella[41], marine microalgae [33], tomatoes [42] and mustard plants [43]. This, however, remains to be confirmed. Sulfate assimilation Most organisms absorb sulfur from the environment in the form of inorganic sulfate and active transport systems for sulfate uptake have been investigated extensively in algae [44–46], bacteria [47], yeast [48], and higher plants [49, 50]. Algae and cyanobacteria appear to undergo sulfur assimilation in a similar manner [51, 52].

As all four strains were isolated from the same region and from the same area proposed for Cyclopia cultivation (the fynbos in the Western Cape of South Africa), the presence of intrinsically high-resistance rhizobia in the field is probable and may present problems when identifying antibiotically-marked strains from the low resistance group in field competition experiments. In addition, concerns have been raised regarding the consequences of releasing antibiotic-resistant bacteria into field environments [60, 61, 49]. Indirect ELISA technique Blasticidin S The indirect ELISA

technique is more suitable than the antibiotic resistance methods for identifying Cyclopia strains in nodules in glasshouse and field studies. There were no cross-reactions between the four test strains, showing that they are antigenically different (Figure 2). All four primary antibodies reacted strongly with

their appropriate homologous strain, producing absorbance readings that were easily distinguished from heterologous strains, and thus made this technique ideal for strain identification in comparative glasshouse and field competition studies. The antibodies raised against strains UCT40a and UCT61a did not cross-react with antigens from any of the three field soils and the antibody raised against strain UCT44b provided only one ambiguous positive result (0.69 OD405 with an antigen derived from the Kanetberg soil), but did not cross-react Epoxomicin nmr Alectinib manufacturer with antigens from the other field sites (Table 5). The antibody raised against strain PPRICI3, on the other hand, produced many false positive results, making the indirect ELISA method unsuitable for identifying this strain in field experiments. The reason for the high level of cross-reactions with the PPRICI3 antibody remains unclear. According to the polyphasic taxonomic investigations of Kock [53], strain PPRICI3 is genetically identical to strain UCT40a. However, because the two strains produced antibodies with different specificity levels, clearly indicates they differ in their

surface antigen characteristics. Conclusion The antibiotic markers were found to be unsuitable for identifying Cyclopia rhizobia in competition experiments under both glasshouse and field conditions. In contrast, the indirect ELISA technique was very successful in identifying the four Cyclopia strains under glasshouse conditions, as well as identifying strains UCT40a, UCT44b and UCT61a (but not strain PPRICI3) in field studies. Acknowledgements This Selleck Pritelivir Research was supported with funds from the Dr. C. Fred Bentley Fellowship (International Development Research Centre, Canada) and B.P. Southern Africa Ltd to AC Spriggs, and with a grant from the National Research Foundation, Pretoria, to FDD. References 1. Arnold T, de Wet BC: Plants of Southern Africa. National Botanical Institute of South Africa 1994. 2.

The resulting values were plotted, with ratio of the human genomic DNA digested with StuI and TH-302 manufacturer undigested human genomic DNA as log2 fold change on the ordinate axis. The nucleotide position of the StuI restriction enzyme site relative to the center of the 9-mer probe is plotted on the abscissa axis. Probe specificity analysis of individual 9-mer probes is confirmed by demonstrating that the center most base governs the hybridization kinetics. This is shown by a reduction in probe signal

intensity values when the human genomic DNA sample was digested with StuI enzyme. The reduction in the probe intensity signal is greater when the restriction enzyme site is located at the center of the 9-mer probe. Therefore the center nucleotide of the probe is the most restrictive in determining the specificity of the probe hybridization complex. (PDF 16 KB) Additional file 5: Table S3 Genomes hybridized on the

array. Genomic DNA from the following genomes was hybridized on the UBDA array. (PDF 9 KB) Additional file 6: Annotation file for 9-mer probes on the UBDA array. (CSV 19 MB) Additional file 7: Annotation file for all other probes on the UBDA array. Genomic DNA from the following genomes was hybridized on the UBDA array. (CSV 6 MB) References 1. Pannucci J, Cai H, Pardington PE, Williams E, Okinaka RT, Kuske CR, Cary selleck chemicals RB: Virulence signatures: microarray-based approaches to discovery and analysis. Biosens Bioelectron 2004,20(4):706–718.PubMedCrossRef 2. Ruiz-Mesa JD, Sanchez-Gonzalez J, Reguera JM, Martin L, Lopez-Palmero S, Colmenero JD: Rose Bengal test: diagnostic yield and use for the rapid diagnosis of human brucellosis in emergency departments in endemic areas. Clin Microbiol Infect 2005,11(3):221–225.PubMedCrossRef 3. Bricker BJ: PCR as a diagnostic tool for

brucellosis. Vet Microbiol 2002,90(1–4):435–446.PubMedCrossRef 17-DMAG (Alvespimycin) HCl 4. Bounaadja L, Albert D, Chenais B, Henault S, Zygmunt MS, Poliak S, Garin-Bastuji B: Real-time PCR for identification of Brucella spp.: a comparative study of IS711, bcsp31 and per target genes. Vet Microbiol 2009,137(1–2):156–164.PubMedCrossRef 5. Hinic V, Brodard I, Thomann A, Holub M, Miserez R, Abril C: IS711-based real-time PCR assay as a tool for detection of Brucella spp. in wild boars and comparison with bacterial isolation and serology. BMC Vet Res 2009, 5:22.PubMedCrossRef 6. Her M, Kang SI, Kim JW, Kim JY, Hwang IY, Jung SC, Park SH, Park MY, Yoo H: A genetic comparison of Brucella abortus isolates from animals and humans by using an MLVA assay. J Microbiol Biotechnol 2010,20(12):1750–1755.PubMed 7. Whatmore AM, Perrett LL, MacMillan AP: Characterisation of the genetic PFT�� concentration diversity of Brucella by multilocus sequencing. BMC Microbiol 2007, 7:34.PubMedCrossRef 8.

We have used two different kinds of commercial GNRs in order to compare their photothermal transduction efficiency. Both are tuned to the laser source and have their maximum surface plasmon resonance (SPR) at 808 nm (longitudinal band). The first commercial GNRs used are bare GNRs (B-GNRs) A12-10-808-100 Nanorodz (Nanopartz, Salt Lake City, UT, USA). B-GNRs are dispersed in deionized water (DI-H2O) with <0.1% ascorbic acid and <0.1% cetyltrimethylammonium bromide (CTAB) surfactant

capping agent. B-GNRs have an axial diameter of 10 nm and a length of 41 nm. The other commercial GNRs used are PEGylated GNRs (PEG-GNRs) PEG-10-808-50 (Nanoseedz, China). GSK126 PEG-GNRs are functionalized by thiol-terminated methoxypoly(ethylene glycol) (mPEG-PH) and are also dispersed in DI-H2O. The

dimensions of PEG-GNRs are equal to the dimensions of B-GNRs (axial diameter = 10 nm, length = 41 nm). The laser is connected to the system via Seliciclib cost a multimode optical fiber with a core diameter of 600 μm, a length of 1.5 m, and a power transmission of 90% to 99% (600-μm MM fiber, Changchun New Industries, China). The laser light from Selleck Vadimezan the fiber irradiates the samples through a collimation lens (78382, Newport Corporation, Irvine, CA, USA), which is in direct contact with a 4-well plate containing the samples, which have a total volume of 500 μl, and is located on a Teflon support. A temperature sensor (F100 Precision Thermometer, Automatic Systems Laboratories, Redhill, UK) is fixed vertically with the aid of a tripod stand and

a burette clamp and remains in contact with the samples during the experiments (Figure 1). Figure 1 Experimental setup: complete view (A), fiber-lens connection details (B), and sample and temperature Niclosamide sensor details (C). Thermal parameters In order to determine the parameters that characterize and describe the thermal behavior of our hyperthermia device, it is needed to develop a thermal model, which can be raised from the resolution of an equivalent electric circuit (Figure 2). Figure 2 Electrical equivalent circuit used to obtain the thermal parameters of the optical hyperthermia device. In this circuit, P is the delivered power, T(t) is the sample temperature which is time dependent, and C d (W/K) and C t (J/K) are the thermal conductance and the thermal capacitance of our experimental enclosure, respectively. Solving the circuit, we can formulate the equation that describes the power distribution, obtaining that the delivered power (P) is equal to the sum of the stored power in the capacitor (P s) and the dissipated power in the resistor (P d): (1) In this equation, T ref – m is the reference temperature (the subscript m refers to the thermal model), that is to say, the initial temperature of our sample before the laser irradiation that should match the environment temperature.

[18, 19] have been further characterised using T-RFLP and 454 pyrosequencing. We found that individuals living in the same environment also tend to develop similar microbiota. Despite of being raised in the same environment and likely

having similar microbiota to begin with, we found, that when hens were transferred to different cages types (conventional cages, furnished cages or aviary) for 2 weeks, minor but uniform changes in the T-RFLP profiles of the microbiota in ileum and caecum occurred. By comparing T-RFLP fingerprints from individual hens, we found highly similar ileal and caecal profiles in hens from same cage, which could be discriminated from other cages in the same experiment. However, the differences were not cage type specific, as when samples from two independent experiments were Anlotinib price compared by PCA, the largest component were observed NCT-501 mouse between experiments, meaning that cage type only had minor influence on the variance. This indicates that the intestinal microbiota

Trichostatin A mouse may be influenced on the contact to the surrounding microbiological environment in the cage. The differences in the evolution of the microbiota were further analysed by deep sequencing of 16S rDNA libraries from pooled caecal samples. When 16 week old laying hens were moved from a floor system and into conventional cages, their caecal microbiota changed towards a less diverse microbiota compared to hens from the same flock that were allocated to aviary and furnished cages. Sequencing of rDNA libraries revealed that hens housed in conventional cages showed a progressive decrease in the number of different OTUs in their caecal microbiota, compared to hens housed in aviary or furnished cages. The decline was already observed after

2 weeks in the cage, and it was even more pronounced after 4 weeks. The same reduction was not observed in the other cage systems. Rucaparib purchase The OTUs that were not recovered in conventional cages were all represented in the other cages, however in low numbers reflecting that they belong to the group of less abundant species. As each OTU represents unique genera or even species, this reflects an overall decrease in diversity of their caecal microbiota towards fewer and more dominating species. Alternative cage systems are characterized by having larger cages due to flock sizes and facilities for enhancing natural behaviour. These facilities may, however, hinder the removal of manure compared to conventional cages, and an overall higher bacterial level has been noted in these systems [1]. It is likely that the laying hens housed in a more contaminated environment, as in the alternative systems, may be more exposed to faeces from the other layers, and thereby continuously being reinoculated, thereby maintaining a higher species variety in the microbiota.